ID: 1077136227_1077136238

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1077136227 1077136238
Species Human (GRCh38) Human (GRCh38)
Location 11:1000495-1000517 11:1000527-1000549
Sequence CCCCCACCCTCCTCCGGCGGCAG CGTGGACGTGTTCTCAGACTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 359} {0: 1, 1: 0, 2: 0, 3: 3, 4: 38}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!