ID: 1077180491_1077180496

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1077180491 1077180496
Species Human (GRCh38) Human (GRCh38)
Location 11:1210420-1210442 11:1210462-1210484
Sequence CCTGATTTCCCACTCCACATCTC TTAATTCCTCTAGTGCCACTGGG
Strand - +
Off-target summary {0: 4, 1: 98, 2: 369, 3: 244, 4: 459} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!