ID: 1077259064_1077259074

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1077259064 1077259074
Species Human (GRCh38) Human (GRCh38)
Location 11:1605960-1605982 11:1606013-1606035
Sequence CCACCACCATGCCTGGCTAATTT ATGTCCTTTTAGAAGTTTCAGGG
Strand - +
Off-target summary {0: 8580, 1: 28158, 2: 52537, 3: 58262, 4: 36129} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!