ID: 1077259066_1077259074

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1077259066 1077259074
Species Human (GRCh38) Human (GRCh38)
Location 11:1605966-1605988 11:1606013-1606035
Sequence CCATGCCTGGCTAATTTTTGTAT ATGTCCTTTTAGAAGTTTCAGGG
Strand - +
Off-target summary {0: 19517, 1: 46347, 2: 91393, 3: 112924, 4: 127532} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!