ID: 1077320887_1077320891

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1077320887 1077320891
Species Human (GRCh38) Human (GRCh38)
Location 11:1941402-1941424 11:1941422-1941444
Sequence CCAGCTGATCAACTCCTGACCTC CTCAGGTGATCCACCCGCCTCGG
Strand - +
Off-target summary No data {0: 9760, 1: 41176, 2: 65950, 3: 79127, 4: 86302}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!