ID: 1077320887_1077320895

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1077320887 1077320895
Species Human (GRCh38) Human (GRCh38)
Location 11:1941402-1941424 11:1941438-1941460
Sequence CCAGCTGATCAACTCCTGACCTC GCCTCGGCCTCTCAAAGTGCTGG
Strand - +
Off-target summary No data {0: 2282, 1: 90269, 2: 217940, 3: 224476, 4: 149748}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!