ID: 1077320887_1077320897

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1077320887 1077320897
Species Human (GRCh38) Human (GRCh38)
Location 11:1941402-1941424 11:1941439-1941461
Sequence CCAGCTGATCAACTCCTGACCTC CCTCGGCCTCTCAAAGTGCTGGG
Strand - +
Off-target summary No data {0: 3703, 1: 132968, 2: 280371, 3: 208243, 4: 120614}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!