ID: 1077332924_1077332937

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1077332924 1077332937
Species Human (GRCh38) Human (GRCh38)
Location 11:1991235-1991257 11:1991266-1991288
Sequence CCCTTCCCAGCAAGCCGGCCTGC TTCCAGGAAGGGGCCCCCGCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 24, 4: 181} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!