ID: 1077336567_1077336572

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1077336567 1077336572
Species Human (GRCh38) Human (GRCh38)
Location 11:2007602-2007624 11:2007648-2007670
Sequence CCTGGGTGGACATGAATTTCCAG AAGTGGTAAGAGACAGATGTAGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 0, 3: 31, 4: 349}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!