ID: 1077370157_1077370162

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1077370157 1077370162
Species Human (GRCh38) Human (GRCh38)
Location 11:2177993-2178015 11:2178006-2178028
Sequence CCCTCCAGCCCTAAGCCTGAGCC AGCCTGAGCCAGCCTGAGTCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!