ID: 1077386086_1077386100

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1077386086 1077386100
Species Human (GRCh38) Human (GRCh38)
Location 11:2270193-2270215 11:2270245-2270267
Sequence CCTCCGGTCTCTGCGGTGGCCGG CCGGGGACGCGGGTCTCCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 67} {0: 1, 1: 0, 2: 2, 3: 7, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!