ID: 1077386090_1077386096

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1077386090 1077386096
Species Human (GRCh38) Human (GRCh38)
Location 11:2270212-2270234 11:2270228-2270250
Sequence CCGGTCGCCGCCGCCGGCTGCAG GCTGCAGCGCAACAGTTCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 207} {0: 1, 1: 0, 2: 0, 3: 4, 4: 46}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!