ID: 1077522899_1077522908

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1077522899 1077522908
Species Human (GRCh38) Human (GRCh38)
Location 11:3046733-3046755 11:3046758-3046780
Sequence CCCCCACATGAAGGTGGAGGAGT CCACAGCCACAGGAGGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 176} {0: 1, 1: 0, 2: 10, 3: 591, 4: 16089}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!