ID: 1077523522_1077523528

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1077523522 1077523528
Species Human (GRCh38) Human (GRCh38)
Location 11:3050330-3050352 11:3050366-3050388
Sequence CCAAGCAGCCACAGGCACCCAGA GCACACTCCCTAGCCAAAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 407} {0: 1, 1: 0, 2: 1, 3: 3, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!