ID: 1077864731_1077864738

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1077864731 1077864738
Species Human (GRCh38) Human (GRCh38)
Location 11:6212589-6212611 11:6212642-6212664
Sequence CCATTCAAAACAACGTCCTCTTG TGGATCCATATCTACTATAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 122} {0: 1, 1: 0, 2: 0, 3: 6, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!