ID: 1077889800_1077889812

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1077889800 1077889812
Species Human (GRCh38) Human (GRCh38)
Location 11:6410884-6410906 11:6410933-6410955
Sequence CCGGCCGCCTTCTCCTCTCCCTC TGATCAGGCCAGGTCCTCGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 17, 3: 204, 4: 1952} {0: 1, 1: 0, 2: 0, 3: 4, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!