ID: 1077905641_1077905647

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1077905641 1077905647
Species Human (GRCh38) Human (GRCh38)
Location 11:6530732-6530754 11:6530747-6530769
Sequence CCTCCTCTTGTACAGGGGGTTCA GGGGTTCAGGCGGGCAAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 65} {0: 1, 1: 0, 2: 2, 3: 19, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!