ID: 1077992535_1077992537

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1077992535 1077992537
Species Human (GRCh38) Human (GRCh38)
Location 11:7424785-7424807 11:7424831-7424853
Sequence CCAAGCTCAACCTTTGTGCATAC CTGCATGTCTGACTGTCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 83} {0: 1, 1: 0, 2: 3, 3: 23, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!