|
Left Crispr |
Right Crispr |
| Crispr ID |
1078014562 |
1078014565 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:7601975-7601997
|
11:7601990-7602012
|
| Sequence |
CCCAGCTACTTGGGAGGCTGAGT |
GGCTGAGTCAGGAGAATCGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1035, 1: 102272, 2: 213099, 3: 252751, 4: 265158} |
{0: 17, 1: 1455, 2: 4893, 3: 4391, 4: 3721} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|