ID: 1078014562_1078014567

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1078014562 1078014567
Species Human (GRCh38) Human (GRCh38)
Location 11:7601975-7601997 11:7602007-7602029
Sequence CCCAGCTACTTGGGAGGCTGAGT CGCTGGAACCCGAGAGACGGAGG
Strand - +
Off-target summary {0: 1035, 1: 102272, 2: 213099, 3: 252751, 4: 265158} {0: 2, 1: 33, 2: 847, 3: 12472, 4: 60059}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!