|
Left Crispr |
Right Crispr |
| Crispr ID |
1078062608 |
1078062610 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:8057756-8057778
|
11:8057773-8057795
|
| Sequence |
CCTGTTAAGAATTCCTTCATTAT |
CATTATTTTGTCATGCTTTAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 70, 1: 101, 2: 99, 3: 77, 4: 240} |
{0: 38, 1: 70, 2: 77, 3: 122, 4: 510} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|