ID: 1078067986_1078067999

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1078067986 1078067999
Species Human (GRCh38) Human (GRCh38)
Location 11:8090316-8090338 11:8090364-8090386
Sequence CCTGACGGGGGATGCCCAGGCTG AGCTGAGTAGGGAGGGCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 178} {0: 1, 1: 0, 2: 6, 3: 55, 4: 582}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!