ID: 1078178231_1078178233

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1078178231 1078178233
Species Human (GRCh38) Human (GRCh38)
Location 11:8987014-8987036 11:8987040-8987062
Sequence CCACACAAAACAAACAAAAGAAA CTGGCTAATTACCCTTATGATGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 81, 3: 1245, 4: 14535} {0: 1, 1: 0, 2: 1, 3: 4, 4: 59}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!