ID: 1078393270_1078393275

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1078393270 1078393275
Species Human (GRCh38) Human (GRCh38)
Location 11:10955113-10955135 11:10955140-10955162
Sequence CCTAGAGACTTGTTGAATGGTTT CAAAATGCTGATAGGGATATGGG
Strand - +
Off-target summary {0: 335, 1: 1966, 2: 1995, 3: 1255, 4: 906} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!