ID: 1078453030_1078453042

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1078453030 1078453042
Species Human (GRCh38) Human (GRCh38)
Location 11:11454400-11454422 11:11454449-11454471
Sequence CCAAGTATCCAGAATAGGACTGT AGGGAGAAGGAAGATAAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 126} {0: 1, 1: 2, 2: 24, 3: 356, 4: 2882}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!