ID: 1078479010_1078479014

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1078479010 1078479014
Species Human (GRCh38) Human (GRCh38)
Location 11:11659983-11660005 11:11660000-11660022
Sequence CCTCCCTAATAGGGATGGGCCTC GGCCTCATCCAATCAGGTGAAGG
Strand - +
Off-target summary No data {0: 16, 1: 220, 2: 583, 3: 866, 4: 1173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!