ID: 1078690774_1078690783

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1078690774 1078690783
Species Human (GRCh38) Human (GRCh38)
Location 11:13578687-13578709 11:13578735-13578757
Sequence CCTGGCAGTGACCACGTGTCACA AGGGAGAGTGCAGGGATTGCGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!