|
Left Crispr |
Right Crispr |
| Crispr ID |
1078857351 |
1078857356 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:15217086-15217108
|
11:15217124-15217146
|
| Sequence |
CCAAGACTGGGTAATTTATAAAG |
GGCTCACAGTTCCACAGGACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3429, 1: 4465, 2: 3325, 3: 3035, 4: 2495} |
{0: 2, 1: 27, 2: 519, 3: 4134, 4: 7915} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|