ID: 1079112330_1079112344

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1079112330 1079112344
Species Human (GRCh38) Human (GRCh38)
Location 11:17611970-17611992 11:17612004-17612026
Sequence CCCCGAGCTCACACTAAGTGCAT ACATGGCTTGTGGTGGGTAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 46} {0: 1, 1: 0, 2: 2, 3: 15, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!