ID: 1079112332_1079112347

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1079112332 1079112347
Species Human (GRCh38) Human (GRCh38)
Location 11:17611972-17611994 11:17612011-17612033
Sequence CCGAGCTCACACTAAGTGCATCG TTGTGGTGGGTAGGGGGTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 60} {0: 1, 1: 0, 2: 5, 3: 94, 4: 1014}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!