ID: 1079368764_1079368767

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1079368764 1079368767
Species Human (GRCh38) Human (GRCh38)
Location 11:19832220-19832242 11:19832261-19832283
Sequence CCTGTCTCATTCAGCCCTCTGCA AGTTTTTCCCTGAATCTTGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 362} {0: 1, 1: 0, 2: 2, 3: 20, 4: 272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!