ID: 1079560292_1079560305

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1079560292 1079560305
Species Human (GRCh38) Human (GRCh38)
Location 11:21812459-21812481 11:21812511-21812533
Sequence CCTCGTGATCCGCCCGCCTCGGC GTCACCGCGCCCGCCGGGAATGG
Strand - +
Off-target summary {0: 11853, 1: 31231, 2: 59993, 3: 65789, 4: 46376} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!