ID: 1079622019_1079622021

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1079622019 1079622021
Species Human (GRCh38) Human (GRCh38)
Location 11:22566921-22566943 11:22566936-22566958
Sequence CCATGGCAGTGGCAGAAGGGTTG AAGGGTTGTCCATTACTTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 30, 4: 242} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!