ID: 1079750685_1079750691

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1079750685 1079750691
Species Human (GRCh38) Human (GRCh38)
Location 11:24192325-24192347 11:24192362-24192384
Sequence CCTCCCACGGAGTCCCTCTCATG CTACAGTTCAAGGTGAGATTTGG
Strand - +
Off-target summary No data {0: 24, 1: 735, 2: 6075, 3: 9138, 4: 9415}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!