ID: 1080016673_1080016676

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1080016673 1080016676
Species Human (GRCh38) Human (GRCh38)
Location 11:27514460-27514482 11:27514497-27514519
Sequence CCCTCTTCAGGTTGTGCATCCTG AGCCACACAATGTATTGTTCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!