ID: 1080196230_1080196238

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1080196230 1080196238
Species Human (GRCh38) Human (GRCh38)
Location 11:29612668-29612690 11:29612715-29612737
Sequence CCCACCGGGACTCCTGCTGGTCA CCTGACAATCCTTTTAGATCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!