|
Left Crispr |
Right Crispr |
Crispr ID |
1080402375 |
1080402382 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
11:31947807-31947829
|
11:31947834-31947856
|
Sequence |
CCCACAGGAAGCCACATCCATAG |
AGAGGGAGAGTACTACATCAAGG |
Strand |
- |
+ |
Off-target summary |
{0: 3, 1: 3, 2: 8, 3: 16, 4: 186} |
{0: 18, 1: 188, 2: 276, 3: 319, 4: 492} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|