ID: 1080402375_1080402383

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1080402375 1080402383
Species Human (GRCh38) Human (GRCh38)
Location 11:31947807-31947829 11:31947835-31947857
Sequence CCCACAGGAAGCCACATCCATAG GAGGGAGAGTACTACATCAAGGG
Strand - +
Off-target summary {0: 3, 1: 3, 2: 8, 3: 16, 4: 186} {0: 18, 1: 172, 2: 283, 3: 310, 4: 438}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!