ID: 1080402375_1080402384

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1080402375 1080402384
Species Human (GRCh38) Human (GRCh38)
Location 11:31947807-31947829 11:31947848-31947870
Sequence CCCACAGGAAGCCACATCCATAG ACATCAAGGGAACACCCCATAGG
Strand - +
Off-target summary {0: 3, 1: 3, 2: 8, 3: 16, 4: 186} {0: 98, 1: 246, 2: 333, 3: 388, 4: 391}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!