ID: 1080461516_1080461521

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1080461516 1080461521
Species Human (GRCh38) Human (GRCh38)
Location 11:32458883-32458905 11:32458903-32458925
Sequence CCAGGCTCATTATGGCTCTGCAG CAGGAAATAGCATGGGTCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 195} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!