ID: 1080513255_1080513259

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1080513255 1080513259
Species Human (GRCh38) Human (GRCh38)
Location 11:32996391-32996413 11:32996421-32996443
Sequence CCAGTACCATATTGTTTTGGCTA CCTGTAGTATAGTTTGAAGTTGG
Strand - +
Off-target summary No data {0: 188, 1: 797, 2: 1153, 3: 1041, 4: 885}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!