ID: 1080513255_1080513260

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1080513255 1080513260
Species Human (GRCh38) Human (GRCh38)
Location 11:32996391-32996413 11:32996422-32996444
Sequence CCAGTACCATATTGTTTTGGCTA CTGTAGTATAGTTTGAAGTTGGG
Strand - +
Off-target summary No data {0: 199, 1: 1154, 2: 15403, 3: 8886, 4: 5634}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!