ID: 1080513256_1080513260

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1080513256 1080513260
Species Human (GRCh38) Human (GRCh38)
Location 11:32996397-32996419 11:32996422-32996444
Sequence CCATATTGTTTTGGCTACTGTAG CTGTAGTATAGTTTGAAGTTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!