ID: 1080639293_1080639305

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1080639293 1080639305
Species Human (GRCh38) Human (GRCh38)
Location 11:34149449-34149471 11:34149490-34149512
Sequence CCAGTAAGAGGGTAACTCCCCCA CATAGCAGGCGGAGCAGGGCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!