ID: 1080650030_1080650039

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1080650030 1080650039
Species Human (GRCh38) Human (GRCh38)
Location 11:34214994-34215016 11:34215025-34215047
Sequence CCAAGTATCTATCATCTGGCCCC GCCCCAGGTGGTGGTGACTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 112} {0: 1, 1: 0, 2: 3, 3: 21, 4: 290}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!