ID: 1080831291_1080831299

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1080831291 1080831299
Species Human (GRCh38) Human (GRCh38)
Location 11:35895630-35895652 11:35895645-35895667
Sequence CCTGTAATCCCAACACTTTGGAA CTTTGGAAGGGCAAGGTGGGCGG
Strand - +
Off-target summary {0: 978, 1: 32713, 2: 325405, 3: 254412, 4: 133373} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!