ID: 1081072773_1081072778

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1081072773 1081072778
Species Human (GRCh38) Human (GRCh38)
Location 11:38631092-38631114 11:38631131-38631153
Sequence CCCTGCCATCTTCTGCAGACATC GACATTTCTTGGCCTGTTACTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 198, 3: 210, 4: 374} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!