ID: 1081496504_1081496505

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1081496504 1081496505
Species Human (GRCh38) Human (GRCh38)
Location 11:43616529-43616551 11:43616571-43616593
Sequence CCAGGCATTGTTCTAAGTGCTTC ATCTTTACAACAACACTTTATGG
Strand - +
Off-target summary {0: 2, 1: 41, 2: 227, 3: 911, 4: 3018} {0: 1, 1: 1, 2: 19, 3: 141, 4: 890}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!