ID: 1081528362_1081528370

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1081528362 1081528370
Species Human (GRCh38) Human (GRCh38)
Location 11:43942390-43942412 11:43942417-43942439
Sequence CCAGCCGCGTGCTCCGGGGCCGC TCTCCCGGAACCCCCGCGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 201} {0: 1, 1: 0, 2: 0, 3: 5, 4: 62}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!