ID: 1081536729_1081536740

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1081536729 1081536740
Species Human (GRCh38) Human (GRCh38)
Location 11:44002130-44002152 11:44002179-44002201
Sequence CCTGCTCCTGAGCCAAGGTGAAA TGGCCCCAGACCACCGGAAAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!